| structure name | CRYSTAL STRUCTURE OF A P53 CORE TETRAMER BOUND TO DNA (mouse p53 core domain) |
| reference | Oncogene 28 325 2009 |
| source | Mus musculus |
| experiment | X-ray (resolution=2.00, R-factor=?) |
| structural superfamily | p53-like transcription factors; |
| sequence family | P53 DNAbinding domain; |
| multimeric complexes | 2geq_AB 3exj_AB |
| redundant complexes | 2geq_B 3exl_A |
| links to other resources | NAKB  PDIdb DNAproDB |
| protein sequence | |
| interface signature | RACR |
Estimated binding specificities ?
| contact |  |
A | 29 24 0 0 13 C | 54 24 0 0 41 G | 0 24 0 96 27 T | 13 24 96 0 15scan! |
Related DNA sequences reported in the literature ?
| site | source | matches (E-value) |
|---|---|---|
| term: P53 | ||
| AGACATGCCTAGACATGCCT | PubMed | 3exj_AB(7.71e-04) |
Dendrogram of similar interfaces ?
matrix format--------ATCTRG +3qyn_C +-----------------------------1 ------------RG +-2 +7b4n_A ! ! RGRT----VCDCRG L --3 +-----------------------------3wu1_A ! RG--TCSC------ +-----------------------------2x6v_A |
home
updated Sun Aug 3 06:49:21 2025