| structure name | CRYSTAL STRUCTURE OF FIS BOUND TO 27 BP SEQUENCE DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT) (DNA-binding protein fis) |
| reference | Hancock et al. 'Nucleic 41 6750 2013 |
| source | Escherichia coli |
| experiment | X-ray (resolution=2.72, R-factor=0.221) |
| structural superfamily | Homeodomain-like; |
| sequence family | Bacterial regulatory protein, Fis family; |
| multimeric complexes | 3iv5_AB 3jr9_AB 3jra_AB 3jrb_AB 3jrc_AB 3jrd_AB 3jre_AB 3jrf_AB 3jrg_AB 3jrh_AB 3jri_AB 4ihv_AB 4ihw_AB 4ihx_AB 4ihy_AB 5ds9_AB 5dtd_AB 5e3l_AB 5e3m_AB 5e3n_AB 5e3o_AB 6p0s_ABE 6p0t_ABE 6p0u_ABEF |
| reference complex | 5ds9_A |
| links to other resources | NAKB PDIdb DNAproDB |
| protein sequence | |
| interface signature | TNRTR |
Estimated binding specificities ?
| contact | ![]() |
A | 13 34 24 54 8 74 C | 57 20 24 14 70 7 G | 13 22 24 14 8 8 T | 13 20 24 14 10 7scan! |
home
updated Sat Aug 2 06:33:45 2025


